Transparent Hospitals

← Institutul de Diagnostic si Sanatate Animala

Amorsa PCR Primer HKU-NF TAATCAGACAAGGAACTGATTA, purificare HPLC, 200 nmoli

DA25613397 · published 2020-05-13 · completed 2020-05-14 · from Filara BioMed Srl (Cluj-Napoca)

399 leiawarded value
—estimated value
33694000-1CPV code
The quantity is not published in the open data. The MS/SEAP export has only the title and value; quantity and unit price appear only in the purchase's SICAP record, which you can look up on e-licitatie.ro.

Description from SEAP

Amorsa PCR Primer HKU-NF TAATCAGACAAGGAACTGATTA, purificare HPLC, 200 nmoli
// ~8,8 mil. de fișe aproape identice: rămân deschise și urmărite, dar în index intră paginile care le adună // (spital, furnizor, CPV, top) — altfel Google le vede ca pagini subțiri și consumă bugetul de crawl pe ele (decizia lui Alex, 24.09).