← Institutul de Diagnostic si Sanatate Animala
Amorsa PCR Sonda E_Sarbeco_P1 6FAM- 5’ACACTAGCCATCCTTACTGCGCTTCG3’ BBQ, purificare HPLC, 200 nmoli
DA25613468 · published 2020-05-13 · completed 2020-05-14 · from Filara BioMed Srl (Cluj-Napoca)
2,138 leiawarded value
—estimated value
33694000-1CPV code
The quantity is not published in the open data. The MS/SEAP export has only the title and value; quantity and unit price appear only in the purchase's SICAP record, which you can look up on e-licitatie.ro.
Description from SEAP
Amorsa PCR Sonda E_Sarbeco_P1 6FAM- 5’ACACTAGCCATCCTTACTGCGCTTCG3’ BBQ, purificare HPLC, 200 nmoli