← Institutul de Diagnostic si Sanatate Animala
Primeri si sonda
DA26532583 · published 2020-10-08 · completed 2020-10-09 · from Filara BioMed Srl (Cluj-Napoca)
914 leiawarded value
—estimated value
33694000-1CPV code
The quantity is not published in the open data. The MS/SEAP export has only the title and value; quantity and unit price appear only in the purchase's SICAP record, which you can look up on e-licitatie.ro.
Description from SEAP
Amorsa PCR Sonda EAV orf7 FAM-TTGCGGACCCGCATCTGACCAA-TAMRA , purificare HPLC, 5 nmoli; Amorsa PCR Primer EAV orf7 R CGGCATCTGCAGTGAGTGA, 20 nmoli; Amorsa PCR Primer EAV orf7 F GGCGACAGCCTACAAGCTACA, 20 nmoli. Mentionam ca aceasta reprezinta comanda ferma.