← Institutul de Diagnostic si Sanatate Animala
Amorsa sonda PCR H5 Probe FAM CCCTAGCACTGGCAATCATG BHQ1, purificare HPLC, 5 nmoli, 5 nmoli
DA27284943 · published 2021-01-26 · completed 2021-01-27 · from Filara BioMed Srl (Cluj-Napoca)
810 leiawarded value
—estimated value
33141625-7CPV code
The quantity is not published in the open data. The MS/SEAP export has only the title and value; quantity and unit price appear only in the purchase's SICAP record, which you can look up on e-licitatie.ro.
Description from SEAP
Amorsa sonda PCR H5 Probe FAM CCCTAGCACTGGCAATCATG BHQ1, purificare HPLC, 5 nmoli