← Institutul de Diagnostic si Sanatate Animala
Amorsa PCR Primer Reverse-K222 CCGAAACTGACATCAAGATAATGG, 20 nmoli
DA27428229 · published 2021-02-18 · completed 2021-02-19 · from Filara BioMed Srl (Cluj-Napoca)
38 leiawarded value
—estimated value
33141625-7CPV code
The quantity is not published in the open data. The MS/SEAP export has only the title and value; quantity and unit price appear only in the purchase's SICAP record, which you can look up on e-licitatie.ro.
Description from SEAP
Amorsa PCR Primer Reverse-K222 CCGAAACTGACATCAAGATAATGG, 20 nmoli