← Institutul de Diagnostic si Sanatate Animala
Amorsa PCR Primer H7 397 ACATACAGTGGGATAAGAACC, 20 nmoli
DA27804638 · published 2021-04-20 · completed 2021-04-22 · from Filara BioMed Srl (Cluj-Napoca)
38 leiawarded value
—estimated value
33694000-1CPV code
The quantity is not published in the open data. The MS/SEAP export has only the title and value; quantity and unit price appear only in the purchase's SICAP record, which you can look up on e-licitatie.ro.
Description from SEAP
Amorsa PCR Primer H7 397 ACATACAGTGGGATAAGAACC, 20 nmoli